Back to Home
Home >> Gene Engineering in Plants >>Gene Cloning Strategies in Plants
Back to Home

Gene Cloning Strategies in Plants - Gene cloning strategies in plants are more or less basically similar to the strategies discussed earlier but with some variations.

The most promising method of transforming plant cells makes use of a plasmid called the Ti plasmid, which is found, within the bacterium Agrobacterium tumefaciens.

Fraley et al. (1983) and An et al. (1985) exploited the natural ability of Agrobacterium tumefaciens to transfer DNA into plant' chromosomes.

This gram negative, rod shaped, motile bacterium lives in soil and invades many dicotyledonous plants and some gymnosperms when they are damaged at soil level.

The bacterium enters the fresh wound and attaches itself to the wall of an intact cell, after which it transfers a relatively small part of its Ti plasmid into the nucleus of the cell.

This plasmid integrates some of its DNA; (T-DNA) into the chromosome of its host plant cells. This is a unique morphogenetic phenomenon wherein a permanent incorporation of a portion of bacterial genome completely diverts the host cells from their predetermined path of development.

This infection results in a crown gall, i.e., a lump or callus of tumor tissue that grows in an undifferentiated way at the site of infection. The cells of the crown gall acquire the properties of independent, unregulated growth.

When crown gall cells are cultured, they grow to form a callus even in media devoid of the plant hormones that must be added to induce normal plant cells to grow in culture.

Ti plasmids have evolved solely for the benefit of the bacterium. The potential of the Agrobacterium Ti plasmid as a vector arises from the ability of the bacterium to somehow transfer and stably integrate a piece of the plasmid DNA into the plant nuclear genome; here is a case of a natural vector system.

The transferred DNA is known as T-DNA and carries several genes which are expressed within the plant and which have dramatic effects on its metabolism. One gene codes for an enzyme which catalyzes synthesis of an opine from amino acids and other common metabolites found within the plant cell.

Opines are never found in normal plants and cannot be metabolized by them, but they can and are used as sources of carbon and nitrogen and the ability both to induce and to metabolize opines is encoded by plasmids in the bacteria.

Two types of opines are produced, namely octopine and nopaline; accordingly there are two kinds of plasmids, namely octopine plasmid and nopaline plasmid.

The two have very similar physical and genetic structures. They are large circles, measuring 140-235 kilobase pairs.

The two plasmids have genes for transfer of the plasmid between bacteria, for opine and arginine catabolism, to ensure that there will not be two types of plasmids in the same cell and to exclude a certain bacteriophage.

They also have genes outside the T-DNA that are necessary for virulence.

It is not known exactly what these control, but it might be attachment of bacteria to plant cell walls, transfer of the plasmid into a plant cell, or integration of the T-DNA into the plant genome.

The two plasmids have the T-DNA itself.

The genes which determine oncogenicity (one) are distributed over wide segments of the plasmids and can also be found as chromosomal markers in the host bacterium.

The genes responsible for the biosynthesis of opines (octopine, ocs: nopaline, nos) as well as genes specifying their degradation (occ: ncc) are found at well defined regions.

Another gene found in nopaline synthesizing plasmids but not in octopine synthesizing plasmids, directs the synthesis of another opine, agrocinopine.

The system for utilization of opines by the bacterial cell requires their active transport into the cell and subsequent cleavage to give the parent amino acid and an a keto acid, both being plasmid-encoded functions.

Either octopine and nopaline plasmids also encode one or more unidentified enzymes in the pathway for the degradation of arginine (arg), the parent amino acid for these opines.

Mutants unable to catabolize octopine have been selected as cells resistant to toxic analogues of octopine.

These mutants synthesize normal levels of octopine, showing that the biosynthetic and degradative processes are independent.

In addition, the plasmid carries genes (tra) which promote plasmid transfer from one bacterial strain to another: genes which confer on the host sensitivity to the antibiotic agrocin produced by certain avirulent strains of Agrobacterium.

Genes which affect the host range of plants that Agrobacterium is able to infect; genes (ape) which give the ability to exclude the bacteriophage API; and genes which confer incompatibility (inc) on the plasmid and which therefore govern the ability to coexist with Ti plasmids of other types.

The T-DNA represents a single contiguous region of the plasmid. This region is often moved into the plant genome as a single piece but in some tumors the T-DNA is split in two and integrated into the plant DNA in two separate places.

There are at least four T-DNA genes that influence tumor morphology. The first two, called tms or Shi genes, apparently inhibit shoot formation since mutants of these genes induce tumors that form shoots. The third gene, called tmr or Roi, apparently inhibits root formation.

Mutants in a fourth tumor-morphology gene, called tml, produce unusually large tumors. Studies of these mutants confirm the hypothesis that the balance of hormones determines growth and development in these tumors.

Tumors from mutants of the tms genes have a tenfold higher ratio of cytokinin to auxin than do wild tumors.

These tumors need auxin for optimum growth in culture. Tumors from tmr mutants require cytokinin for optimal growth in culture.

The tmr gene codes for the enzyme isopentenyl transferase, the first enzyme in the cytokinin pathway.

From the point of view of someone wanting to insert genes into a plant cell genome, the genes that control integration of the T-DNA into the plant DNA are among the most interesting.

Studies with modified Ti plas­mids show that the border regions of the T-DNA are necessary for integration (especially the right region).

There is a 25 base-pair sequence directly repeated at the right ends of the T -DNA and this sequence may be involved in the mechanism of integration.

Direct repeats in a 25 bp box occurring at either end of the T-DNA region is common to both octopine and nopaline plasmids.

The DNA sequence for the nopaline boxes is as follows.

Nopaline left TGTGGCAGGATATATTGTGGTGTAAACAA

Nopaline right TTTGACAGGATATATTGGCGGGTAAACCT

Consensus nopaline . . . tGCAGGATATAT tg . . . gCTA aac . . .

Experiments have shown that one 25 bp box at either end suffices to direct the interaction between Ti plasmid DNA and plant DNA. Up to 50 kb foreign DNA can replace the central part of the. T -region and then integrate into the plant genome.

The internal genes of the T-DNA are not necessary for integration although they are necessary for tumor formation. The internal genes can be replaced with foreign genes, which are then integrated under control of the border regions. This provides a mechanism for transforming cells with a wide variety of genes.

Even though Ti plasmid DNA is an ideal vector, it poses several problems. Firstly, the plasmids are large and this does not allow for easy manipulation of their DNA; also, they have a large number of restriction sites which are not usefully distributed.

Secondly, the plasmids transfer functions on the T-DNA which specify production of substances which effectively convert the infected cells into tumor cells and these cannot be readily regenerated into whole plants. Thirdly, only dicotyledonous plants are infected.

In spite of these problems, the potential of Ti plasmid as a vector for the genetic manipulation of plants was quickly recognized. The genes in T-DNA are eukaryotic in nature, even though derived from a bacterial plasmid, and are transcribed by the plant's RNA polymerase; they contain introns, which are excised correctly during maturation of the mRNA.

Two properties of the T-DNA of Ti plasmids make them virtually ideal vectors for introducing foreign genes into plants. First, the host range of Agrobacterium is quite broad; they are capable of transforming cells of virtually all dicotyledonous plants.

Whether the range can eventually be broadened to include monocotyledons remains to be seen. Secondly, the integrated T-DNA is inherited in a Mendelian way and its genes have their own promoters to which foreign genes can be coupled and expressed.

The Agrobacterium cell is in effect a miniature genetic engineer that can bring the stable insertion of foreign genes into the plant cell genome. The bacterium does not cause tumors on cereal plants but there is indirect evidence that it can introduce DNA into some embryonic tissues of cereals.

Plant molecular biologists have now taken advantage of this ability and have adapted the Ti plasmid as a vector for accomplishing the long envis aged goal of introducing functional new genes into plants.

Before the Ti plasmid could be developed as a successful vector, however, investigators had to learn a great deal about the basic molecular biology of the plasmid and of plant gene expression.